ID: 1175117589

View in Genome Browser
Species Human (GRCh38)
Location 20:56694048-56694070
Sequence CTTCAGGCACAGATGGATCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175117587_1175117589 -8 Left 1175117587 20:56694033-56694055 CCAAGAGTGTACAAGCTTCAGGC No data
Right 1175117589 20:56694048-56694070 CTTCAGGCACAGATGGATCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175117589 Original CRISPR CTTCAGGCACAGATGGATCT AGG Intergenic
No off target data available for this crispr