ID: 1175119593

View in Genome Browser
Species Human (GRCh38)
Location 20:56707847-56707869
Sequence CTGAGGAATGCCAGGATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175119593_1175119598 21 Left 1175119593 20:56707847-56707869 CCATCCATCCTGGCATTCCTCAG No data
Right 1175119598 20:56707891-56707913 TCTCTGCCTCCATCTTCAAATGG 0: 3
1: 95
2: 354
3: 865
4: 1658
1175119593_1175119599 22 Left 1175119593 20:56707847-56707869 CCATCCATCCTGGCATTCCTCAG No data
Right 1175119599 20:56707892-56707914 CTCTGCCTCCATCTTCAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175119593 Original CRISPR CTGAGGAATGCCAGGATGGA TGG (reversed) Intergenic
No off target data available for this crispr