ID: 1175121842

View in Genome Browser
Species Human (GRCh38)
Location 20:56721901-56721923
Sequence GGGTAGGACGGGAGGGAAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175121842_1175121852 -4 Left 1175121842 20:56721901-56721923 CCGCCTTCCCTCCCGTCCTACCC No data
Right 1175121852 20:56721920-56721942 ACCCACTGGGACCCTCGGACTGG No data
1175121842_1175121850 -9 Left 1175121842 20:56721901-56721923 CCGCCTTCCCTCCCGTCCTACCC No data
Right 1175121850 20:56721915-56721937 GTCCTACCCACTGGGACCCTCGG No data
1175121842_1175121855 4 Left 1175121842 20:56721901-56721923 CCGCCTTCCCTCCCGTCCTACCC No data
Right 1175121855 20:56721928-56721950 GGACCCTCGGACTGGTTCCAAGG No data
1175121842_1175121858 14 Left 1175121842 20:56721901-56721923 CCGCCTTCCCTCCCGTCCTACCC No data
Right 1175121858 20:56721938-56721960 ACTGGTTCCAAGGAGCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175121842 Original CRISPR GGGTAGGACGGGAGGGAAGG CGG (reversed) Intergenic
No off target data available for this crispr