ID: 1175125778

View in Genome Browser
Species Human (GRCh38)
Location 20:56750618-56750640
Sequence GCACCCTGATTGGCTTAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175125775_1175125778 -1 Left 1175125775 20:56750596-56750618 CCGTGGAAGGCAGGGAGGGGGGG No data
Right 1175125778 20:56750618-56750640 GCACCCTGATTGGCTTAGACAGG No data
1175125769_1175125778 6 Left 1175125769 20:56750589-56750611 CCAATCGCCGTGGAAGGCAGGGA No data
Right 1175125778 20:56750618-56750640 GCACCCTGATTGGCTTAGACAGG No data
1175125765_1175125778 12 Left 1175125765 20:56750583-56750605 CCTGAGCCAATCGCCGTGGAAGG No data
Right 1175125778 20:56750618-56750640 GCACCCTGATTGGCTTAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175125778 Original CRISPR GCACCCTGATTGGCTTAGAC AGG Intergenic
No off target data available for this crispr