ID: 1175125838

View in Genome Browser
Species Human (GRCh38)
Location 20:56750848-56750870
Sequence CGGGGTGAGCAGAGGGACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175125838_1175125842 -5 Left 1175125838 20:56750848-56750870 CCTGTGTCCCTCTGCTCACCCCG No data
Right 1175125842 20:56750866-56750888 CCCCGCCCGTATCCCAAGCCAGG No data
1175125838_1175125844 -4 Left 1175125838 20:56750848-56750870 CCTGTGTCCCTCTGCTCACCCCG No data
Right 1175125844 20:56750867-56750889 CCCGCCCGTATCCCAAGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175125838 Original CRISPR CGGGGTGAGCAGAGGGACAC AGG (reversed) Intergenic
No off target data available for this crispr