ID: 1175128995

View in Genome Browser
Species Human (GRCh38)
Location 20:56775112-56775134
Sequence CAGGAGAAAGAGAAGGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175128995_1175129001 -7 Left 1175128995 20:56775112-56775134 CCCTCCCCCTTCTCTTTCTCCTG No data
Right 1175129001 20:56775128-56775150 TCTCCTGCTCCAGCCATGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175128995 Original CRISPR CAGGAGAAAGAGAAGGGGGA GGG (reversed) Intergenic
No off target data available for this crispr