ID: 1175129001

View in Genome Browser
Species Human (GRCh38)
Location 20:56775128-56775150
Sequence TCTCCTGCTCCAGCCATGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175128994_1175129001 -6 Left 1175128994 20:56775111-56775133 CCCCTCCCCCTTCTCTTTCTCCT No data
Right 1175129001 20:56775128-56775150 TCTCCTGCTCCAGCCATGTAAGG No data
1175128995_1175129001 -7 Left 1175128995 20:56775112-56775134 CCCTCCCCCTTCTCTTTCTCCTG No data
Right 1175129001 20:56775128-56775150 TCTCCTGCTCCAGCCATGTAAGG No data
1175128996_1175129001 -8 Left 1175128996 20:56775113-56775135 CCTCCCCCTTCTCTTTCTCCTGC No data
Right 1175129001 20:56775128-56775150 TCTCCTGCTCCAGCCATGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175129001 Original CRISPR TCTCCTGCTCCAGCCATGTA AGG Intergenic
No off target data available for this crispr