ID: 1175129145

View in Genome Browser
Species Human (GRCh38)
Location 20:56776084-56776106
Sequence ACACCCTACTTGTGGAAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175129141_1175129145 9 Left 1175129141 20:56776052-56776074 CCAGTTCTAAGTGTTTTCTGTCC No data
Right 1175129145 20:56776084-56776106 ACACCCTACTTGTGGAAAGTGGG No data
1175129140_1175129145 26 Left 1175129140 20:56776035-56776057 CCACTCAGCAGATCTGGCCAGTT No data
Right 1175129145 20:56776084-56776106 ACACCCTACTTGTGGAAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175129145 Original CRISPR ACACCCTACTTGTGGAAAGT GGG Intergenic
No off target data available for this crispr