ID: 1175133829

View in Genome Browser
Species Human (GRCh38)
Location 20:56808509-56808531
Sequence GACAGGCCCCCAGCCATGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175133829_1175133848 23 Left 1175133829 20:56808509-56808531 CCACCCATGGCTGGGGGCCTGTC No data
Right 1175133848 20:56808555-56808577 TGCTGTTTCCGGGTTTCCTGGGG No data
1175133829_1175133838 0 Left 1175133829 20:56808509-56808531 CCACCCATGGCTGGGGGCCTGTC No data
Right 1175133838 20:56808532-56808554 CCAGGGCCAGCCTGCCTCCCGGG No data
1175133829_1175133847 22 Left 1175133829 20:56808509-56808531 CCACCCATGGCTGGGGGCCTGTC No data
Right 1175133847 20:56808554-56808576 GTGCTGTTTCCGGGTTTCCTGGG No data
1175133829_1175133842 13 Left 1175133829 20:56808509-56808531 CCACCCATGGCTGGGGGCCTGTC No data
Right 1175133842 20:56808545-56808567 GCCTCCCGGGTGCTGTTTCCGGG No data
1175133829_1175133841 12 Left 1175133829 20:56808509-56808531 CCACCCATGGCTGGGGGCCTGTC No data
Right 1175133841 20:56808544-56808566 TGCCTCCCGGGTGCTGTTTCCGG No data
1175133829_1175133836 -1 Left 1175133829 20:56808509-56808531 CCACCCATGGCTGGGGGCCTGTC No data
Right 1175133836 20:56808531-56808553 CCCAGGGCCAGCCTGCCTCCCGG No data
1175133829_1175133846 21 Left 1175133829 20:56808509-56808531 CCACCCATGGCTGGGGGCCTGTC No data
Right 1175133846 20:56808553-56808575 GGTGCTGTTTCCGGGTTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175133829 Original CRISPR GACAGGCCCCCAGCCATGGG TGG (reversed) Intergenic
No off target data available for this crispr