ID: 1175133830

View in Genome Browser
Species Human (GRCh38)
Location 20:56808512-56808534
Sequence TGGGACAGGCCCCCAGCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175133830_1175133846 18 Left 1175133830 20:56808512-56808534 CCCATGGCTGGGGGCCTGTCCCA No data
Right 1175133846 20:56808553-56808575 GGTGCTGTTTCCGGGTTTCCTGG No data
1175133830_1175133841 9 Left 1175133830 20:56808512-56808534 CCCATGGCTGGGGGCCTGTCCCA No data
Right 1175133841 20:56808544-56808566 TGCCTCCCGGGTGCTGTTTCCGG No data
1175133830_1175133836 -4 Left 1175133830 20:56808512-56808534 CCCATGGCTGGGGGCCTGTCCCA No data
Right 1175133836 20:56808531-56808553 CCCAGGGCCAGCCTGCCTCCCGG No data
1175133830_1175133842 10 Left 1175133830 20:56808512-56808534 CCCATGGCTGGGGGCCTGTCCCA No data
Right 1175133842 20:56808545-56808567 GCCTCCCGGGTGCTGTTTCCGGG No data
1175133830_1175133848 20 Left 1175133830 20:56808512-56808534 CCCATGGCTGGGGGCCTGTCCCA No data
Right 1175133848 20:56808555-56808577 TGCTGTTTCCGGGTTTCCTGGGG No data
1175133830_1175133847 19 Left 1175133830 20:56808512-56808534 CCCATGGCTGGGGGCCTGTCCCA No data
Right 1175133847 20:56808554-56808576 GTGCTGTTTCCGGGTTTCCTGGG No data
1175133830_1175133838 -3 Left 1175133830 20:56808512-56808534 CCCATGGCTGGGGGCCTGTCCCA No data
Right 1175133838 20:56808532-56808554 CCAGGGCCAGCCTGCCTCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175133830 Original CRISPR TGGGACAGGCCCCCAGCCAT GGG (reversed) Intergenic
No off target data available for this crispr