ID: 1175133835

View in Genome Browser
Species Human (GRCh38)
Location 20:56808531-56808553
Sequence CCGGGAGGCAGGCTGGCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175133835_1175133850 16 Left 1175133835 20:56808531-56808553 CCCAGGGCCAGCCTGCCTCCCGG No data
Right 1175133850 20:56808570-56808592 TCCTGGGGAGCTTTCATCCCTGG No data
1175133835_1175133846 -1 Left 1175133835 20:56808531-56808553 CCCAGGGCCAGCCTGCCTCCCGG No data
Right 1175133846 20:56808553-56808575 GGTGCTGTTTCCGGGTTTCCTGG No data
1175133835_1175133853 23 Left 1175133835 20:56808531-56808553 CCCAGGGCCAGCCTGCCTCCCGG No data
Right 1175133853 20:56808577-56808599 GAGCTTTCATCCCTGGGCACAGG No data
1175133835_1175133841 -10 Left 1175133835 20:56808531-56808553 CCCAGGGCCAGCCTGCCTCCCGG No data
Right 1175133841 20:56808544-56808566 TGCCTCCCGGGTGCTGTTTCCGG No data
1175133835_1175133847 0 Left 1175133835 20:56808531-56808553 CCCAGGGCCAGCCTGCCTCCCGG No data
Right 1175133847 20:56808554-56808576 GTGCTGTTTCCGGGTTTCCTGGG No data
1175133835_1175133854 24 Left 1175133835 20:56808531-56808553 CCCAGGGCCAGCCTGCCTCCCGG No data
Right 1175133854 20:56808578-56808600 AGCTTTCATCCCTGGGCACAGGG No data
1175133835_1175133852 17 Left 1175133835 20:56808531-56808553 CCCAGGGCCAGCCTGCCTCCCGG No data
Right 1175133852 20:56808571-56808593 CCTGGGGAGCTTTCATCCCTGGG No data
1175133835_1175133842 -9 Left 1175133835 20:56808531-56808553 CCCAGGGCCAGCCTGCCTCCCGG No data
Right 1175133842 20:56808545-56808567 GCCTCCCGGGTGCTGTTTCCGGG No data
1175133835_1175133855 27 Left 1175133835 20:56808531-56808553 CCCAGGGCCAGCCTGCCTCCCGG No data
Right 1175133855 20:56808581-56808603 TTTCATCCCTGGGCACAGGGTGG No data
1175133835_1175133848 1 Left 1175133835 20:56808531-56808553 CCCAGGGCCAGCCTGCCTCCCGG No data
Right 1175133848 20:56808555-56808577 TGCTGTTTCCGGGTTTCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175133835 Original CRISPR CCGGGAGGCAGGCTGGCCCT GGG (reversed) Intergenic
No off target data available for this crispr