ID: 1175133846

View in Genome Browser
Species Human (GRCh38)
Location 20:56808553-56808575
Sequence GGTGCTGTTTCCGGGTTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175133834_1175133846 4 Left 1175133834 20:56808526-56808548 CCTGTCCCAGGGCCAGCCTGCCT No data
Right 1175133846 20:56808553-56808575 GGTGCTGTTTCCGGGTTTCCTGG No data
1175133827_1175133846 23 Left 1175133827 20:56808507-56808529 CCCCACCCATGGCTGGGGGCCTG No data
Right 1175133846 20:56808553-56808575 GGTGCTGTTTCCGGGTTTCCTGG No data
1175133837_1175133846 -2 Left 1175133837 20:56808532-56808554 CCAGGGCCAGCCTGCCTCCCGGG No data
Right 1175133846 20:56808553-56808575 GGTGCTGTTTCCGGGTTTCCTGG No data
1175133831_1175133846 17 Left 1175133831 20:56808513-56808535 CCATGGCTGGGGGCCTGTCCCAG No data
Right 1175133846 20:56808553-56808575 GGTGCTGTTTCCGGGTTTCCTGG No data
1175133828_1175133846 22 Left 1175133828 20:56808508-56808530 CCCACCCATGGCTGGGGGCCTGT No data
Right 1175133846 20:56808553-56808575 GGTGCTGTTTCCGGGTTTCCTGG No data
1175133835_1175133846 -1 Left 1175133835 20:56808531-56808553 CCCAGGGCCAGCCTGCCTCCCGG No data
Right 1175133846 20:56808553-56808575 GGTGCTGTTTCCGGGTTTCCTGG No data
1175133829_1175133846 21 Left 1175133829 20:56808509-56808531 CCACCCATGGCTGGGGGCCTGTC No data
Right 1175133846 20:56808553-56808575 GGTGCTGTTTCCGGGTTTCCTGG No data
1175133830_1175133846 18 Left 1175133830 20:56808512-56808534 CCCATGGCTGGGGGCCTGTCCCA No data
Right 1175133846 20:56808553-56808575 GGTGCTGTTTCCGGGTTTCCTGG No data
1175133839_1175133846 -8 Left 1175133839 20:56808538-56808560 CCAGCCTGCCTCCCGGGTGCTGT No data
Right 1175133846 20:56808553-56808575 GGTGCTGTTTCCGGGTTTCCTGG No data
1175133825_1175133846 27 Left 1175133825 20:56808503-56808525 CCATCCCCACCCATGGCTGGGGG No data
Right 1175133846 20:56808553-56808575 GGTGCTGTTTCCGGGTTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175133846 Original CRISPR GGTGCTGTTTCCGGGTTTCC TGG Intergenic
No off target data available for this crispr