ID: 1175134154

View in Genome Browser
Species Human (GRCh38)
Location 20:56810327-56810349
Sequence CTTCCTCCCAACATGGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175134154_1175134158 -3 Left 1175134154 20:56810327-56810349 CCAGCCACCATGTTGGGAGGAAG No data
Right 1175134158 20:56810347-56810369 AAGCCCAAGCCTGCCCACATGGG No data
1175134154_1175134165 14 Left 1175134154 20:56810327-56810349 CCAGCCACCATGTTGGGAGGAAG No data
Right 1175134165 20:56810364-56810386 CATGGGTAGAACACATGGAGAGG No data
1175134154_1175134157 -4 Left 1175134154 20:56810327-56810349 CCAGCCACCATGTTGGGAGGAAG No data
Right 1175134157 20:56810346-56810368 GAAGCCCAAGCCTGCCCACATGG No data
1175134154_1175134162 9 Left 1175134154 20:56810327-56810349 CCAGCCACCATGTTGGGAGGAAG No data
Right 1175134162 20:56810359-56810381 GCCCACATGGGTAGAACACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175134154 Original CRISPR CTTCCTCCCAACATGGTGGC TGG (reversed) Intergenic
No off target data available for this crispr