ID: 1175135452

View in Genome Browser
Species Human (GRCh38)
Location 20:56820221-56820243
Sequence GGAAACAGCCTGTCACCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175135449_1175135452 25 Left 1175135449 20:56820173-56820195 CCTGTCTGTCTCTCTGTCTCTTT No data
Right 1175135452 20:56820221-56820243 GGAAACAGCCTGTCACCTCATGG No data
1175135448_1175135452 26 Left 1175135448 20:56820172-56820194 CCCTGTCTGTCTCTCTGTCTCTT No data
Right 1175135452 20:56820221-56820243 GGAAACAGCCTGTCACCTCATGG No data
1175135447_1175135452 29 Left 1175135447 20:56820169-56820191 CCTCCCTGTCTGTCTCTCTGTCT No data
Right 1175135452 20:56820221-56820243 GGAAACAGCCTGTCACCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175135452 Original CRISPR GGAAACAGCCTGTCACCTCA TGG Intergenic
No off target data available for this crispr