ID: 1175136650

View in Genome Browser
Species Human (GRCh38)
Location 20:56829277-56829299
Sequence AAGGGTAAACGCCCTGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175136650_1175136657 9 Left 1175136650 20:56829277-56829299 CCCACCTCAGGGCGTTTACCCTT No data
Right 1175136657 20:56829309-56829331 CCCTCTCCAAGTTCTGCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175136650 Original CRISPR AAGGGTAAACGCCCTGAGGT GGG (reversed) Intergenic
No off target data available for this crispr