ID: 1175141378

View in Genome Browser
Species Human (GRCh38)
Location 20:56862707-56862729
Sequence GGTTTCTGCTGGGATCCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175141378_1175141384 -4 Left 1175141378 20:56862707-56862729 CCCCCTGGATCCCAGCAGAAACC No data
Right 1175141384 20:56862726-56862748 AACCTCTCCTCCGCTGTCCCTGG No data
1175141378_1175141392 24 Left 1175141378 20:56862707-56862729 CCCCCTGGATCCCAGCAGAAACC No data
Right 1175141392 20:56862754-56862776 TTCTCCCCAAAAGATATCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175141378 Original CRISPR GGTTTCTGCTGGGATCCAGG GGG (reversed) Intergenic
No off target data available for this crispr