ID: 1175142537

View in Genome Browser
Species Human (GRCh38)
Location 20:56871824-56871846
Sequence ATGGGTGATCAAAAGGAAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175142537_1175142545 11 Left 1175142537 20:56871824-56871846 CCGCCTTCCTTTTGATCACCCAT No data
Right 1175142545 20:56871858-56871880 CCCCTCAGGAATTCCCTCCACGG No data
1175142537_1175142550 22 Left 1175142537 20:56871824-56871846 CCGCCTTCCTTTTGATCACCCAT No data
Right 1175142550 20:56871869-56871891 TTCCCTCCACGGGCAGGTCCTGG No data
1175142537_1175142547 12 Left 1175142537 20:56871824-56871846 CCGCCTTCCTTTTGATCACCCAT No data
Right 1175142547 20:56871859-56871881 CCCTCAGGAATTCCCTCCACGGG No data
1175142537_1175142542 -3 Left 1175142537 20:56871824-56871846 CCGCCTTCCTTTTGATCACCCAT No data
Right 1175142542 20:56871844-56871866 CATGTCCTGTGATTCCCCTCAGG No data
1175142537_1175142549 16 Left 1175142537 20:56871824-56871846 CCGCCTTCCTTTTGATCACCCAT No data
Right 1175142549 20:56871863-56871885 CAGGAATTCCCTCCACGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175142537 Original CRISPR ATGGGTGATCAAAAGGAAGG CGG (reversed) Intergenic
No off target data available for this crispr