ID: 1175144433

View in Genome Browser
Species Human (GRCh38)
Location 20:56885055-56885077
Sequence TGTCCACAGCTGCTCCCAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175144429_1175144433 30 Left 1175144429 20:56885002-56885024 CCATTTCTCTCAGTTTGAGGTTC No data
Right 1175144433 20:56885055-56885077 TGTCCACAGCTGCTCCCAACTGG No data
1175144431_1175144433 3 Left 1175144431 20:56885029-56885051 CCTTCCTCTCTGAGATGGTTTGC No data
Right 1175144433 20:56885055-56885077 TGTCCACAGCTGCTCCCAACTGG No data
1175144432_1175144433 -1 Left 1175144432 20:56885033-56885055 CCTCTCTGAGATGGTTTGCTAGT No data
Right 1175144433 20:56885055-56885077 TGTCCACAGCTGCTCCCAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175144433 Original CRISPR TGTCCACAGCTGCTCCCAAC TGG Intergenic
No off target data available for this crispr