ID: 1175144714 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 20:56886761-56886783 |
| Sequence | CTCCATGTTGAATAGGAGCT GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 2398 | |||
| Summary | {0: 5, 1: 238, 2: 732, 3: 762, 4: 661} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1175144708_1175144714 | 28 | Left | 1175144708 | 20:56886710-56886732 | CCAGGAGGCTGAGGTGGAAGGAT | 0: 45 1: 646 2: 1243 3: 1899 4: 5649 |
||
| Right | 1175144714 | 20:56886761-56886783 | CTCCATGTTGAATAGGAGCTGGG | 0: 5 1: 238 2: 732 3: 762 4: 661 |
||||
| 1175144710_1175144714 | 3 | Left | 1175144710 | 20:56886735-56886757 | CCTTGTCAGAGGCATGTGAACCA | No data | ||
| Right | 1175144714 | 20:56886761-56886783 | CTCCATGTTGAATAGGAGCTGGG | 0: 5 1: 238 2: 732 3: 762 4: 661 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1175144714 | Original CRISPR | CTCCATGTTGAATAGGAGCT GGG | Intergenic | ||
| Too many off-targets to display for this crispr | |||||