ID: 1175144714

View in Genome Browser
Species Human (GRCh38)
Location 20:56886761-56886783
Sequence CTCCATGTTGAATAGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2398
Summary {0: 5, 1: 238, 2: 732, 3: 762, 4: 661}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175144708_1175144714 28 Left 1175144708 20:56886710-56886732 CCAGGAGGCTGAGGTGGAAGGAT 0: 45
1: 646
2: 1243
3: 1899
4: 5649
Right 1175144714 20:56886761-56886783 CTCCATGTTGAATAGGAGCTGGG 0: 5
1: 238
2: 732
3: 762
4: 661
1175144710_1175144714 3 Left 1175144710 20:56886735-56886757 CCTTGTCAGAGGCATGTGAACCA No data
Right 1175144714 20:56886761-56886783 CTCCATGTTGAATAGGAGCTGGG 0: 5
1: 238
2: 732
3: 762
4: 661

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175144714 Original CRISPR CTCCATGTTGAATAGGAGCT GGG Intergenic
Too many off-targets to display for this crispr