ID: 1175146135

View in Genome Browser
Species Human (GRCh38)
Location 20:56897780-56897802
Sequence CAGCTGGCATAGGTGGCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175146120_1175146135 24 Left 1175146120 20:56897733-56897755 CCCCAAGTGTGTGCTGGGCTTTC No data
Right 1175146135 20:56897780-56897802 CAGCTGGCATAGGTGGCCCAGGG No data
1175146125_1175146135 1 Left 1175146125 20:56897756-56897778 CCAGGTCAGCCTCCCTCCAGCAG No data
Right 1175146135 20:56897780-56897802 CAGCTGGCATAGGTGGCCCAGGG No data
1175146122_1175146135 22 Left 1175146122 20:56897735-56897757 CCAAGTGTGTGCTGGGCTTTCCC No data
Right 1175146135 20:56897780-56897802 CAGCTGGCATAGGTGGCCCAGGG No data
1175146121_1175146135 23 Left 1175146121 20:56897734-56897756 CCCAAGTGTGTGCTGGGCTTTCC No data
Right 1175146135 20:56897780-56897802 CAGCTGGCATAGGTGGCCCAGGG No data
1175146124_1175146135 2 Left 1175146124 20:56897755-56897777 CCCAGGTCAGCCTCCCTCCAGCA No data
Right 1175146135 20:56897780-56897802 CAGCTGGCATAGGTGGCCCAGGG No data
1175146128_1175146135 -8 Left 1175146128 20:56897765-56897787 CCTCCCTCCAGCAGGCAGCTGGC No data
Right 1175146135 20:56897780-56897802 CAGCTGGCATAGGTGGCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175146135 Original CRISPR CAGCTGGCATAGGTGGCCCA GGG Intergenic
No off target data available for this crispr