ID: 1175146840

View in Genome Browser
Species Human (GRCh38)
Location 20:56903401-56903423
Sequence GGGTCGACAAACTCTACCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175146840_1175146849 23 Left 1175146840 20:56903401-56903423 CCAGAGGTAGAGTTTGTCGACCC No data
Right 1175146849 20:56903447-56903469 GACTTGCTTTGGGTGGCCAATGG No data
1175146840_1175146847 13 Left 1175146840 20:56903401-56903423 CCAGAGGTAGAGTTTGTCGACCC No data
Right 1175146847 20:56903437-56903459 TTGGTCATGTGACTTGCTTTGGG No data
1175146840_1175146848 16 Left 1175146840 20:56903401-56903423 CCAGAGGTAGAGTTTGTCGACCC No data
Right 1175146848 20:56903440-56903462 GTCATGTGACTTGCTTTGGGTGG No data
1175146840_1175146850 24 Left 1175146840 20:56903401-56903423 CCAGAGGTAGAGTTTGTCGACCC No data
Right 1175146850 20:56903448-56903470 ACTTGCTTTGGGTGGCCAATGGG No data
1175146840_1175146846 12 Left 1175146840 20:56903401-56903423 CCAGAGGTAGAGTTTGTCGACCC No data
Right 1175146846 20:56903436-56903458 CTTGGTCATGTGACTTGCTTTGG No data
1175146840_1175146843 -6 Left 1175146840 20:56903401-56903423 CCAGAGGTAGAGTTTGTCGACCC No data
Right 1175146843 20:56903418-56903440 CGACCCTTTGGATCTTGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175146840 Original CRISPR GGGTCGACAAACTCTACCTC TGG (reversed) Intergenic
No off target data available for this crispr