ID: 1175147460

View in Genome Browser
Species Human (GRCh38)
Location 20:56907690-56907712
Sequence TCATTTTGACTGGTGGATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175147460_1175147470 22 Left 1175147460 20:56907690-56907712 CCCTGATCCACCAGTCAAAATGA No data
Right 1175147470 20:56907735-56907757 AACTCCCCAGGAAGTACAGTTGG No data
1175147460_1175147468 10 Left 1175147460 20:56907690-56907712 CCCTGATCCACCAGTCAAAATGA No data
Right 1175147468 20:56907723-56907745 CCTTTTCCTCTGAACTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175147460 Original CRISPR TCATTTTGACTGGTGGATCA GGG (reversed) Intergenic
No off target data available for this crispr