ID: 1175147914

View in Genome Browser
Species Human (GRCh38)
Location 20:56910756-56910778
Sequence TGTAGGCTATTCCAGAGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175147906_1175147914 16 Left 1175147906 20:56910717-56910739 CCTGGCTGGGAATGCGAGTTGAC No data
Right 1175147914 20:56910756-56910778 TGTAGGCTATTCCAGAGCCAGGG No data
1175147904_1175147914 25 Left 1175147904 20:56910708-56910730 CCCACATCTCCTGGCTGGGAATG No data
Right 1175147914 20:56910756-56910778 TGTAGGCTATTCCAGAGCCAGGG No data
1175147905_1175147914 24 Left 1175147905 20:56910709-56910731 CCACATCTCCTGGCTGGGAATGC No data
Right 1175147914 20:56910756-56910778 TGTAGGCTATTCCAGAGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175147914 Original CRISPR TGTAGGCTATTCCAGAGCCA GGG Intergenic
No off target data available for this crispr