ID: 1175155294

View in Genome Browser
Species Human (GRCh38)
Location 20:56967287-56967309
Sequence ACGGAGAAGAAAGAGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175155294_1175155298 6 Left 1175155294 20:56967287-56967309 CCAGCCTCCTCTTTCTTCTCCGT No data
Right 1175155298 20:56967316-56967338 GCCAGCACAAGACTGAGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175155294 Original CRISPR ACGGAGAAGAAAGAGGAGGC TGG (reversed) Intergenic
No off target data available for this crispr