ID: 1175155298

View in Genome Browser
Species Human (GRCh38)
Location 20:56967316-56967338
Sequence GCCAGCACAAGACTGAGCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175155289_1175155298 26 Left 1175155289 20:56967267-56967289 CCCAGCCCAGTGGTTAGTTCCCA No data
Right 1175155298 20:56967316-56967338 GCCAGCACAAGACTGAGCACAGG No data
1175155288_1175155298 27 Left 1175155288 20:56967266-56967288 CCCCAGCCCAGTGGTTAGTTCCC No data
Right 1175155298 20:56967316-56967338 GCCAGCACAAGACTGAGCACAGG No data
1175155292_1175155298 20 Left 1175155292 20:56967273-56967295 CCAGTGGTTAGTTCCCAGCCTCC No data
Right 1175155298 20:56967316-56967338 GCCAGCACAAGACTGAGCACAGG No data
1175155290_1175155298 25 Left 1175155290 20:56967268-56967290 CCAGCCCAGTGGTTAGTTCCCAG No data
Right 1175155298 20:56967316-56967338 GCCAGCACAAGACTGAGCACAGG No data
1175155291_1175155298 21 Left 1175155291 20:56967272-56967294 CCCAGTGGTTAGTTCCCAGCCTC No data
Right 1175155298 20:56967316-56967338 GCCAGCACAAGACTGAGCACAGG No data
1175155294_1175155298 6 Left 1175155294 20:56967287-56967309 CCAGCCTCCTCTTTCTTCTCCGT No data
Right 1175155298 20:56967316-56967338 GCCAGCACAAGACTGAGCACAGG No data
1175155293_1175155298 7 Left 1175155293 20:56967286-56967308 CCCAGCCTCCTCTTTCTTCTCCG No data
Right 1175155298 20:56967316-56967338 GCCAGCACAAGACTGAGCACAGG No data
1175155296_1175155298 -1 Left 1175155296 20:56967294-56967316 CCTCTTTCTTCTCCGTTCAGATG No data
Right 1175155298 20:56967316-56967338 GCCAGCACAAGACTGAGCACAGG No data
1175155295_1175155298 2 Left 1175155295 20:56967291-56967313 CCTCCTCTTTCTTCTCCGTTCAG No data
Right 1175155298 20:56967316-56967338 GCCAGCACAAGACTGAGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175155298 Original CRISPR GCCAGCACAAGACTGAGCAC AGG Intergenic
No off target data available for this crispr