ID: 1175157630

View in Genome Browser
Species Human (GRCh38)
Location 20:56982647-56982669
Sequence ACAGGTCAGAGCTCTGCAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175157630_1175157635 5 Left 1175157630 20:56982647-56982669 CCTACTGCAGAGCTCTGACCTGT No data
Right 1175157635 20:56982675-56982697 TGCAGCCAGGTTCTTACTGATGG No data
1175157630_1175157639 12 Left 1175157630 20:56982647-56982669 CCTACTGCAGAGCTCTGACCTGT No data
Right 1175157639 20:56982682-56982704 AGGTTCTTACTGATGGGGAATGG No data
1175157630_1175157633 -8 Left 1175157630 20:56982647-56982669 CCTACTGCAGAGCTCTGACCTGT No data
Right 1175157633 20:56982662-56982684 TGACCTGTGTGGGTGCAGCCAGG No data
1175157630_1175157641 30 Left 1175157630 20:56982647-56982669 CCTACTGCAGAGCTCTGACCTGT No data
Right 1175157641 20:56982700-56982722 AATGGGAAGCCAATTGATAGAGG No data
1175157630_1175157636 6 Left 1175157630 20:56982647-56982669 CCTACTGCAGAGCTCTGACCTGT No data
Right 1175157636 20:56982676-56982698 GCAGCCAGGTTCTTACTGATGGG No data
1175157630_1175157640 13 Left 1175157630 20:56982647-56982669 CCTACTGCAGAGCTCTGACCTGT No data
Right 1175157640 20:56982683-56982705 GGTTCTTACTGATGGGGAATGGG No data
1175157630_1175157637 7 Left 1175157630 20:56982647-56982669 CCTACTGCAGAGCTCTGACCTGT No data
Right 1175157637 20:56982677-56982699 CAGCCAGGTTCTTACTGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175157630 Original CRISPR ACAGGTCAGAGCTCTGCAGT AGG (reversed) Intergenic
No off target data available for this crispr