ID: 1175157634

View in Genome Browser
Species Human (GRCh38)
Location 20:56982665-56982687
Sequence GAACCTGGCTGCACCCACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175157634_1175157639 -6 Left 1175157634 20:56982665-56982687 CCTGTGTGGGTGCAGCCAGGTTC No data
Right 1175157639 20:56982682-56982704 AGGTTCTTACTGATGGGGAATGG No data
1175157634_1175157641 12 Left 1175157634 20:56982665-56982687 CCTGTGTGGGTGCAGCCAGGTTC No data
Right 1175157641 20:56982700-56982722 AATGGGAAGCCAATTGATAGAGG No data
1175157634_1175157640 -5 Left 1175157634 20:56982665-56982687 CCTGTGTGGGTGCAGCCAGGTTC No data
Right 1175157640 20:56982683-56982705 GGTTCTTACTGATGGGGAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175157634 Original CRISPR GAACCTGGCTGCACCCACAC AGG (reversed) Intergenic
No off target data available for this crispr