ID: 1175157639

View in Genome Browser
Species Human (GRCh38)
Location 20:56982682-56982704
Sequence AGGTTCTTACTGATGGGGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175157630_1175157639 12 Left 1175157630 20:56982647-56982669 CCTACTGCAGAGCTCTGACCTGT No data
Right 1175157639 20:56982682-56982704 AGGTTCTTACTGATGGGGAATGG No data
1175157634_1175157639 -6 Left 1175157634 20:56982665-56982687 CCTGTGTGGGTGCAGCCAGGTTC No data
Right 1175157639 20:56982682-56982704 AGGTTCTTACTGATGGGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175157639 Original CRISPR AGGTTCTTACTGATGGGGAA TGG Intergenic
No off target data available for this crispr