ID: 1175159006

View in Genome Browser
Species Human (GRCh38)
Location 20:56994231-56994253
Sequence CTGGGCAAACATCAGCAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175159005_1175159006 -9 Left 1175159005 20:56994217-56994239 CCACGTCACGGATGCTGGGCAAA No data
Right 1175159006 20:56994231-56994253 CTGGGCAAACATCAGCAGCAAGG No data
1175159001_1175159006 9 Left 1175159001 20:56994199-56994221 CCAAGTAAGGAAGAGCAGCCACG No data
Right 1175159006 20:56994231-56994253 CTGGGCAAACATCAGCAGCAAGG No data
1175158998_1175159006 29 Left 1175158998 20:56994179-56994201 CCCTCTCTCTTGGTCTGTGTCCA No data
Right 1175159006 20:56994231-56994253 CTGGGCAAACATCAGCAGCAAGG No data
1175158999_1175159006 28 Left 1175158999 20:56994180-56994202 CCTCTCTCTTGGTCTGTGTCCAA No data
Right 1175159006 20:56994231-56994253 CTGGGCAAACATCAGCAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175159006 Original CRISPR CTGGGCAAACATCAGCAGCA AGG Intergenic
No off target data available for this crispr