ID: 1175160659

View in Genome Browser
Species Human (GRCh38)
Location 20:57005327-57005349
Sequence AGTGAGGTACCAGCAGGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175160646_1175160659 19 Left 1175160646 20:57005285-57005307 CCCAGGTCAGGGTGGGGTGCATC No data
Right 1175160659 20:57005327-57005349 AGTGAGGTACCAGCAGGGAAGGG No data
1175160645_1175160659 20 Left 1175160645 20:57005284-57005306 CCCCAGGTCAGGGTGGGGTGCAT No data
Right 1175160659 20:57005327-57005349 AGTGAGGTACCAGCAGGGAAGGG No data
1175160647_1175160659 18 Left 1175160647 20:57005286-57005308 CCAGGTCAGGGTGGGGTGCATCT No data
Right 1175160659 20:57005327-57005349 AGTGAGGTACCAGCAGGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175160659 Original CRISPR AGTGAGGTACCAGCAGGGAA GGG Intergenic
No off target data available for this crispr