ID: 1175162460

View in Genome Browser
Species Human (GRCh38)
Location 20:57019144-57019166
Sequence TGCACAGGACAGCCCCACAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175162460_1175162465 27 Left 1175162460 20:57019144-57019166 CCGCTGTGGGGCTGTCCTGTGCA No data
Right 1175162465 20:57019194-57019216 CTCCTACCCACTCAATGCCAGGG No data
1175162460_1175162466 28 Left 1175162460 20:57019144-57019166 CCGCTGTGGGGCTGTCCTGTGCA No data
Right 1175162466 20:57019195-57019217 TCCTACCCACTCAATGCCAGGGG No data
1175162460_1175162464 26 Left 1175162460 20:57019144-57019166 CCGCTGTGGGGCTGTCCTGTGCA No data
Right 1175162464 20:57019193-57019215 ACTCCTACCCACTCAATGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175162460 Original CRISPR TGCACAGGACAGCCCCACAG CGG (reversed) Intergenic
No off target data available for this crispr