ID: 1175162702

View in Genome Browser
Species Human (GRCh38)
Location 20:57020807-57020829
Sequence GGCAAGGCGGGTGCCCCCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175162702_1175162715 25 Left 1175162702 20:57020807-57020829 CCCTCGGGGGCACCCGCCTTGCC No data
Right 1175162715 20:57020855-57020877 GGCTCACCCACATTTGCTGTTGG No data
1175162702_1175162712 4 Left 1175162702 20:57020807-57020829 CCCTCGGGGGCACCCGCCTTGCC No data
Right 1175162712 20:57020834-57020856 CTGGAGCCACCTGACATTTGGGG No data
1175162702_1175162711 3 Left 1175162702 20:57020807-57020829 CCCTCGGGGGCACCCGCCTTGCC No data
Right 1175162711 20:57020833-57020855 CCTGGAGCCACCTGACATTTGGG No data
1175162702_1175162709 2 Left 1175162702 20:57020807-57020829 CCCTCGGGGGCACCCGCCTTGCC No data
Right 1175162709 20:57020832-57020854 TCCTGGAGCCACCTGACATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175162702 Original CRISPR GGCAAGGCGGGTGCCCCCGA GGG (reversed) Intergenic