ID: 1175165261

View in Genome Browser
Species Human (GRCh38)
Location 20:57039043-57039065
Sequence GGCACACAGTCTTGAAGCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175165261_1175165266 22 Left 1175165261 20:57039043-57039065 CCGCAGCTTCAAGACTGTGTGCC No data
Right 1175165266 20:57039088-57039110 ATGAATAAATGGATGGATAATGG No data
1175165261_1175165265 15 Left 1175165261 20:57039043-57039065 CCGCAGCTTCAAGACTGTGTGCC No data
Right 1175165265 20:57039081-57039103 GCACATGATGAATAAATGGATGG No data
1175165261_1175165264 11 Left 1175165261 20:57039043-57039065 CCGCAGCTTCAAGACTGTGTGCC No data
Right 1175165264 20:57039077-57039099 GTGAGCACATGATGAATAAATGG No data
1175165261_1175165267 26 Left 1175165261 20:57039043-57039065 CCGCAGCTTCAAGACTGTGTGCC No data
Right 1175165267 20:57039092-57039114 ATAAATGGATGGATAATGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175165261 Original CRISPR GGCACACAGTCTTGAAGCTG CGG (reversed) Intergenic
No off target data available for this crispr