ID: 1175165263

View in Genome Browser
Species Human (GRCh38)
Location 20:57039064-57039086
Sequence ATGTGCTCACTGAGCATACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175165263_1175165270 27 Left 1175165263 20:57039064-57039086 CCTGGTATGCTCAGTGAGCACAT No data
Right 1175165270 20:57039114-57039136 GATGATGGATGGAAGATGAATGG No data
1175165263_1175165268 12 Left 1175165263 20:57039064-57039086 CCTGGTATGCTCAGTGAGCACAT No data
Right 1175165268 20:57039099-57039121 GATGGATAATGGATGGATGATGG 0: 8
1: 33
2: 76
3: 213
4: 715
1175165263_1175165266 1 Left 1175165263 20:57039064-57039086 CCTGGTATGCTCAGTGAGCACAT No data
Right 1175165266 20:57039088-57039110 ATGAATAAATGGATGGATAATGG No data
1175165263_1175165267 5 Left 1175165263 20:57039064-57039086 CCTGGTATGCTCAGTGAGCACAT No data
Right 1175165267 20:57039092-57039114 ATAAATGGATGGATAATGGATGG No data
1175165263_1175165265 -6 Left 1175165263 20:57039064-57039086 CCTGGTATGCTCAGTGAGCACAT No data
Right 1175165265 20:57039081-57039103 GCACATGATGAATAAATGGATGG No data
1175165263_1175165264 -10 Left 1175165263 20:57039064-57039086 CCTGGTATGCTCAGTGAGCACAT No data
Right 1175165264 20:57039077-57039099 GTGAGCACATGATGAATAAATGG No data
1175165263_1175165269 16 Left 1175165263 20:57039064-57039086 CCTGGTATGCTCAGTGAGCACAT No data
Right 1175165269 20:57039103-57039125 GATAATGGATGGATGATGGATGG 0: 7
1: 28
2: 77
3: 313
4: 1083

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175165263 Original CRISPR ATGTGCTCACTGAGCATACC AGG (reversed) Intergenic
No off target data available for this crispr