ID: 1175165266

View in Genome Browser
Species Human (GRCh38)
Location 20:57039088-57039110
Sequence ATGAATAAATGGATGGATAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175165263_1175165266 1 Left 1175165263 20:57039064-57039086 CCTGGTATGCTCAGTGAGCACAT No data
Right 1175165266 20:57039088-57039110 ATGAATAAATGGATGGATAATGG No data
1175165261_1175165266 22 Left 1175165261 20:57039043-57039065 CCGCAGCTTCAAGACTGTGTGCC No data
Right 1175165266 20:57039088-57039110 ATGAATAAATGGATGGATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175165266 Original CRISPR ATGAATAAATGGATGGATAA TGG Intergenic
No off target data available for this crispr