ID: 1175165537

View in Genome Browser
Species Human (GRCh38)
Location 20:57041303-57041325
Sequence GTCCCCAAGGGGCCAGAAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175165537_1175165547 -1 Left 1175165537 20:57041303-57041325 CCCGCTTCTGGCCCCTTGGGGAC No data
Right 1175165547 20:57041325-57041347 CCCACTCTGGGCAGTGGGCACGG No data
1175165537_1175165544 -7 Left 1175165537 20:57041303-57041325 CCCGCTTCTGGCCCCTTGGGGAC No data
Right 1175165544 20:57041319-57041341 TGGGGACCCACTCTGGGCAGTGG No data
1175165537_1175165549 30 Left 1175165537 20:57041303-57041325 CCCGCTTCTGGCCCCTTGGGGAC No data
Right 1175165549 20:57041356-57041378 TACTTGACTGCTGTGATCTTTGG No data
1175165537_1175165545 -6 Left 1175165537 20:57041303-57041325 CCCGCTTCTGGCCCCTTGGGGAC No data
Right 1175165545 20:57041320-57041342 GGGGACCCACTCTGGGCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175165537 Original CRISPR GTCCCCAAGGGGCCAGAAGC GGG (reversed) Intergenic
No off target data available for this crispr