ID: 1175166860

View in Genome Browser
Species Human (GRCh38)
Location 20:57050122-57050144
Sequence GCTGAGTCAGGGCTCCGACC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175166860_1175166867 21 Left 1175166860 20:57050122-57050144 CCGGGTCGGAGCCCTGACTCAGC No data
Right 1175166867 20:57050166-57050188 TTGGGCAGCTTTTTAACCTCTGG No data
1175166860_1175166865 3 Left 1175166860 20:57050122-57050144 CCGGGTCGGAGCCCTGACTCAGC No data
Right 1175166865 20:57050148-57050170 TTGCTTACCTGTGTGATCTTGGG No data
1175166860_1175166864 2 Left 1175166860 20:57050122-57050144 CCGGGTCGGAGCCCTGACTCAGC No data
Right 1175166864 20:57050147-57050169 CTTGCTTACCTGTGTGATCTTGG No data
1175166860_1175166869 30 Left 1175166860 20:57050122-57050144 CCGGGTCGGAGCCCTGACTCAGC No data
Right 1175166869 20:57050175-57050197 TTTTTAACCTCTGGGAGCCTCGG No data
1175166860_1175166868 22 Left 1175166860 20:57050122-57050144 CCGGGTCGGAGCCCTGACTCAGC No data
Right 1175166868 20:57050167-57050189 TGGGCAGCTTTTTAACCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175166860 Original CRISPR GCTGAGTCAGGGCTCCGACC CGG (reversed) Intergenic
No off target data available for this crispr