ID: 1175166861

View in Genome Browser
Species Human (GRCh38)
Location 20:57050133-57050155
Sequence GTAAGCAAGTGGCTGAGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175166861_1175166864 -9 Left 1175166861 20:57050133-57050155 CCCTGACTCAGCCACTTGCTTAC No data
Right 1175166864 20:57050147-57050169 CTTGCTTACCTGTGTGATCTTGG No data
1175166861_1175166865 -8 Left 1175166861 20:57050133-57050155 CCCTGACTCAGCCACTTGCTTAC No data
Right 1175166865 20:57050148-57050170 TTGCTTACCTGTGTGATCTTGGG No data
1175166861_1175166868 11 Left 1175166861 20:57050133-57050155 CCCTGACTCAGCCACTTGCTTAC No data
Right 1175166868 20:57050167-57050189 TGGGCAGCTTTTTAACCTCTGGG No data
1175166861_1175166867 10 Left 1175166861 20:57050133-57050155 CCCTGACTCAGCCACTTGCTTAC No data
Right 1175166867 20:57050166-57050188 TTGGGCAGCTTTTTAACCTCTGG No data
1175166861_1175166869 19 Left 1175166861 20:57050133-57050155 CCCTGACTCAGCCACTTGCTTAC No data
Right 1175166869 20:57050175-57050197 TTTTTAACCTCTGGGAGCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175166861 Original CRISPR GTAAGCAAGTGGCTGAGTCA GGG (reversed) Intergenic
No off target data available for this crispr