ID: 1175166863

View in Genome Browser
Species Human (GRCh38)
Location 20:57050144-57050166
Sequence AGATCACACAGGTAAGCAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175166863_1175166868 0 Left 1175166863 20:57050144-57050166 CCACTTGCTTACCTGTGTGATCT No data
Right 1175166868 20:57050167-57050189 TGGGCAGCTTTTTAACCTCTGGG No data
1175166863_1175166869 8 Left 1175166863 20:57050144-57050166 CCACTTGCTTACCTGTGTGATCT No data
Right 1175166869 20:57050175-57050197 TTTTTAACCTCTGGGAGCCTCGG No data
1175166863_1175166867 -1 Left 1175166863 20:57050144-57050166 CCACTTGCTTACCTGTGTGATCT No data
Right 1175166867 20:57050166-57050188 TTGGGCAGCTTTTTAACCTCTGG No data
1175166863_1175166872 29 Left 1175166863 20:57050144-57050166 CCACTTGCTTACCTGTGTGATCT No data
Right 1175166872 20:57050196-57050218 GGTTTCTCCCTGTGCAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175166863 Original CRISPR AGATCACACAGGTAAGCAAG TGG (reversed) Intergenic
No off target data available for this crispr