ID: 1175166869

View in Genome Browser
Species Human (GRCh38)
Location 20:57050175-57050197
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175166860_1175166869 30 Left 1175166860 20:57050122-57050144 CCGGGTCGGAGCCCTGACTCAGC No data
Right 1175166869 20:57050175-57050197 TTTTTAACCTCTGGGAGCCTCGG No data
1175166866_1175166869 -3 Left 1175166866 20:57050155-57050177 CCTGTGTGATCTTGGGCAGCTTT No data
Right 1175166869 20:57050175-57050197 TTTTTAACCTCTGGGAGCCTCGG No data
1175166863_1175166869 8 Left 1175166863 20:57050144-57050166 CCACTTGCTTACCTGTGTGATCT No data
Right 1175166869 20:57050175-57050197 TTTTTAACCTCTGGGAGCCTCGG No data
1175166861_1175166869 19 Left 1175166861 20:57050133-57050155 CCCTGACTCAGCCACTTGCTTAC No data
Right 1175166869 20:57050175-57050197 TTTTTAACCTCTGGGAGCCTCGG No data
1175166862_1175166869 18 Left 1175166862 20:57050134-57050156 CCTGACTCAGCCACTTGCTTACC No data
Right 1175166869 20:57050175-57050197 TTTTTAACCTCTGGGAGCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175166869 Original CRISPR TTTTTAACCTCTGGGAGCCT CGG Intergenic
No off target data available for this crispr