ID: 1175166870

View in Genome Browser
Species Human (GRCh38)
Location 20:57050182-57050204
Sequence GGAGAAACCGAGGCTCCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175166870_1175166877 24 Left 1175166870 20:57050182-57050204 CCTCTGGGAGCCTCGGTTTCTCC No data
Right 1175166877 20:57050229-57050251 GGAATACAGTGGTCCCCCATTGG No data
1175166870_1175166872 -9 Left 1175166870 20:57050182-57050204 CCTCTGGGAGCCTCGGTTTCTCC No data
Right 1175166872 20:57050196-57050218 GGTTTCTCCCTGTGCAAAACAGG No data
1175166870_1175166876 13 Left 1175166870 20:57050182-57050204 CCTCTGGGAGCCTCGGTTTCTCC No data
Right 1175166876 20:57050218-57050240 GCATGATAATAGGAATACAGTGG No data
1175166870_1175166875 3 Left 1175166870 20:57050182-57050204 CCTCTGGGAGCCTCGGTTTCTCC No data
Right 1175166875 20:57050208-57050230 TGCAAAACAGGCATGATAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175166870 Original CRISPR GGAGAAACCGAGGCTCCCAG AGG (reversed) Intergenic
No off target data available for this crispr