ID: 1175166872

View in Genome Browser
Species Human (GRCh38)
Location 20:57050196-57050218
Sequence GGTTTCTCCCTGTGCAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175166870_1175166872 -9 Left 1175166870 20:57050182-57050204 CCTCTGGGAGCCTCGGTTTCTCC No data
Right 1175166872 20:57050196-57050218 GGTTTCTCCCTGTGCAAAACAGG No data
1175166863_1175166872 29 Left 1175166863 20:57050144-57050166 CCACTTGCTTACCTGTGTGATCT No data
Right 1175166872 20:57050196-57050218 GGTTTCTCCCTGTGCAAAACAGG No data
1175166866_1175166872 18 Left 1175166866 20:57050155-57050177 CCTGTGTGATCTTGGGCAGCTTT No data
Right 1175166872 20:57050196-57050218 GGTTTCTCCCTGTGCAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175166872 Original CRISPR GGTTTCTCCCTGTGCAAAAC AGG Intergenic
No off target data available for this crispr