ID: 1175166876

View in Genome Browser
Species Human (GRCh38)
Location 20:57050218-57050240
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175166873_1175166876 -8 Left 1175166873 20:57050203-57050225 CCCTGTGCAAAACAGGCATGATA No data
Right 1175166876 20:57050218-57050240 GCATGATAATAGGAATACAGTGG No data
1175166870_1175166876 13 Left 1175166870 20:57050182-57050204 CCTCTGGGAGCCTCGGTTTCTCC No data
Right 1175166876 20:57050218-57050240 GCATGATAATAGGAATACAGTGG No data
1175166871_1175166876 3 Left 1175166871 20:57050192-57050214 CCTCGGTTTCTCCCTGTGCAAAA No data
Right 1175166876 20:57050218-57050240 GCATGATAATAGGAATACAGTGG No data
1175166874_1175166876 -9 Left 1175166874 20:57050204-57050226 CCTGTGCAAAACAGGCATGATAA No data
Right 1175166876 20:57050218-57050240 GCATGATAATAGGAATACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175166876 Original CRISPR GCATGATAATAGGAATACAG TGG Intergenic
No off target data available for this crispr