ID: 1175167096

View in Genome Browser
Species Human (GRCh38)
Location 20:57052057-57052079
Sequence ATTTAGGTTTAGAAATGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175167090_1175167096 12 Left 1175167090 20:57052022-57052044 CCTGGACTTGAGGCAGCTTGAGG No data
Right 1175167096 20:57052057-57052079 ATTTAGGTTTAGAAATGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175167096 Original CRISPR ATTTAGGTTTAGAAATGGAG AGG Intergenic
No off target data available for this crispr