ID: 1175167543

View in Genome Browser
Species Human (GRCh38)
Location 20:57055423-57055445
Sequence CAGCAGGCCCTCTGCAGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175167536_1175167543 -6 Left 1175167536 20:57055406-57055428 CCACACACACCCGTAAACAGCAG No data
Right 1175167543 20:57055423-57055445 CAGCAGGCCCTCTGCAGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175167543 Original CRISPR CAGCAGGCCCTCTGCAGAGG GGG Intergenic
No off target data available for this crispr