ID: 1175173768

View in Genome Browser
Species Human (GRCh38)
Location 20:57097422-57097444
Sequence CCATGTGACCAGAGGGAGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175173768_1175173783 29 Left 1175173768 20:57097422-57097444 CCGTCCTCCCTCTGGTCACATGG No data
Right 1175173783 20:57097474-57097496 GTCAAGCAGGACAGGGGATATGG No data
1175173768_1175173781 22 Left 1175173768 20:57097422-57097444 CCGTCCTCCCTCTGGTCACATGG No data
Right 1175173781 20:57097467-57097489 ACTCTCTGTCAAGCAGGACAGGG No data
1175173768_1175173780 21 Left 1175173768 20:57097422-57097444 CCGTCCTCCCTCTGGTCACATGG No data
Right 1175173780 20:57097466-57097488 CACTCTCTGTCAAGCAGGACAGG No data
1175173768_1175173777 16 Left 1175173768 20:57097422-57097444 CCGTCCTCCCTCTGGTCACATGG No data
Right 1175173777 20:57097461-57097483 ACTCCCACTCTCTGTCAAGCAGG No data
1175173768_1175173775 -8 Left 1175173768 20:57097422-57097444 CCGTCCTCCCTCTGGTCACATGG No data
Right 1175173775 20:57097437-57097459 TCACATGGAGGGAGTGTCCTAGG No data
1175173768_1175173782 23 Left 1175173768 20:57097422-57097444 CCGTCCTCCCTCTGGTCACATGG No data
Right 1175173782 20:57097468-57097490 CTCTCTGTCAAGCAGGACAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175173768 Original CRISPR CCATGTGACCAGAGGGAGGA CGG (reversed) Intergenic
No off target data available for this crispr