ID: 1175173775

View in Genome Browser
Species Human (GRCh38)
Location 20:57097437-57097459
Sequence TCACATGGAGGGAGTGTCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175173759_1175173775 20 Left 1175173759 20:57097394-57097416 CCTGGAAGCCAGCCACCCTGAGC No data
Right 1175173775 20:57097437-57097459 TCACATGGAGGGAGTGTCCTAGG No data
1175173763_1175173775 4 Left 1175173763 20:57097410-57097432 CCTGAGCCCTGCCCGTCCTCCCT No data
Right 1175173775 20:57097437-57097459 TCACATGGAGGGAGTGTCCTAGG No data
1175173761_1175173775 8 Left 1175173761 20:57097406-57097428 CCACCCTGAGCCCTGCCCGTCCT No data
Right 1175173775 20:57097437-57097459 TCACATGGAGGGAGTGTCCTAGG No data
1175173760_1175173775 12 Left 1175173760 20:57097402-57097424 CCAGCCACCCTGAGCCCTGCCCG No data
Right 1175173775 20:57097437-57097459 TCACATGGAGGGAGTGTCCTAGG No data
1175173766_1175173775 -3 Left 1175173766 20:57097417-57097439 CCTGCCCGTCCTCCCTCTGGTCA No data
Right 1175173775 20:57097437-57097459 TCACATGGAGGGAGTGTCCTAGG No data
1175173762_1175173775 5 Left 1175173762 20:57097409-57097431 CCCTGAGCCCTGCCCGTCCTCCC No data
Right 1175173775 20:57097437-57097459 TCACATGGAGGGAGTGTCCTAGG No data
1175173768_1175173775 -8 Left 1175173768 20:57097422-57097444 CCGTCCTCCCTCTGGTCACATGG No data
Right 1175173775 20:57097437-57097459 TCACATGGAGGGAGTGTCCTAGG No data
1175173767_1175173775 -7 Left 1175173767 20:57097421-57097443 CCCGTCCTCCCTCTGGTCACATG No data
Right 1175173775 20:57097437-57097459 TCACATGGAGGGAGTGTCCTAGG No data
1175173765_1175173775 -2 Left 1175173765 20:57097416-57097438 CCCTGCCCGTCCTCCCTCTGGTC No data
Right 1175173775 20:57097437-57097459 TCACATGGAGGGAGTGTCCTAGG No data
1175173758_1175173775 21 Left 1175173758 20:57097393-57097415 CCCTGGAAGCCAGCCACCCTGAG No data
Right 1175173775 20:57097437-57097459 TCACATGGAGGGAGTGTCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175173775 Original CRISPR TCACATGGAGGGAGTGTCCT AGG Intergenic
No off target data available for this crispr