ID: 1175173777

View in Genome Browser
Species Human (GRCh38)
Location 20:57097461-57097483
Sequence ACTCCCACTCTCTGTCAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175173767_1175173777 17 Left 1175173767 20:57097421-57097443 CCCGTCCTCCCTCTGGTCACATG No data
Right 1175173777 20:57097461-57097483 ACTCCCACTCTCTGTCAAGCAGG No data
1175173771_1175173777 12 Left 1175173771 20:57097426-57097448 CCTCCCTCTGGTCACATGGAGGG No data
Right 1175173777 20:57097461-57097483 ACTCCCACTCTCTGTCAAGCAGG No data
1175173774_1175173777 8 Left 1175173774 20:57097430-57097452 CCTCTGGTCACATGGAGGGAGTG No data
Right 1175173777 20:57097461-57097483 ACTCCCACTCTCTGTCAAGCAGG No data
1175173763_1175173777 28 Left 1175173763 20:57097410-57097432 CCTGAGCCCTGCCCGTCCTCCCT No data
Right 1175173777 20:57097461-57097483 ACTCCCACTCTCTGTCAAGCAGG No data
1175173768_1175173777 16 Left 1175173768 20:57097422-57097444 CCGTCCTCCCTCTGGTCACATGG No data
Right 1175173777 20:57097461-57097483 ACTCCCACTCTCTGTCAAGCAGG No data
1175173766_1175173777 21 Left 1175173766 20:57097417-57097439 CCTGCCCGTCCTCCCTCTGGTCA No data
Right 1175173777 20:57097461-57097483 ACTCCCACTCTCTGTCAAGCAGG No data
1175173773_1175173777 9 Left 1175173773 20:57097429-57097451 CCCTCTGGTCACATGGAGGGAGT No data
Right 1175173777 20:57097461-57097483 ACTCCCACTCTCTGTCAAGCAGG No data
1175173765_1175173777 22 Left 1175173765 20:57097416-57097438 CCCTGCCCGTCCTCCCTCTGGTC No data
Right 1175173777 20:57097461-57097483 ACTCCCACTCTCTGTCAAGCAGG No data
1175173762_1175173777 29 Left 1175173762 20:57097409-57097431 CCCTGAGCCCTGCCCGTCCTCCC No data
Right 1175173777 20:57097461-57097483 ACTCCCACTCTCTGTCAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175173777 Original CRISPR ACTCCCACTCTCTGTCAAGC AGG Intergenic
No off target data available for this crispr