ID: 1175173783

View in Genome Browser
Species Human (GRCh38)
Location 20:57097474-57097496
Sequence GTCAAGCAGGACAGGGGATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175173773_1175173783 22 Left 1175173773 20:57097429-57097451 CCCTCTGGTCACATGGAGGGAGT No data
Right 1175173783 20:57097474-57097496 GTCAAGCAGGACAGGGGATATGG No data
1175173767_1175173783 30 Left 1175173767 20:57097421-57097443 CCCGTCCTCCCTCTGGTCACATG No data
Right 1175173783 20:57097474-57097496 GTCAAGCAGGACAGGGGATATGG No data
1175173774_1175173783 21 Left 1175173774 20:57097430-57097452 CCTCTGGTCACATGGAGGGAGTG No data
Right 1175173783 20:57097474-57097496 GTCAAGCAGGACAGGGGATATGG No data
1175173768_1175173783 29 Left 1175173768 20:57097422-57097444 CCGTCCTCCCTCTGGTCACATGG No data
Right 1175173783 20:57097474-57097496 GTCAAGCAGGACAGGGGATATGG No data
1175173776_1175173783 -3 Left 1175173776 20:57097454-57097476 CCTAGGCACTCCCACTCTCTGTC No data
Right 1175173783 20:57097474-57097496 GTCAAGCAGGACAGGGGATATGG No data
1175173771_1175173783 25 Left 1175173771 20:57097426-57097448 CCTCCCTCTGGTCACATGGAGGG No data
Right 1175173783 20:57097474-57097496 GTCAAGCAGGACAGGGGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175173783 Original CRISPR GTCAAGCAGGACAGGGGATA TGG Intergenic
No off target data available for this crispr