ID: 1175176178

View in Genome Browser
Species Human (GRCh38)
Location 20:57113818-57113840
Sequence ATGGATCCTCCTCTTGGCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175176178_1175176185 26 Left 1175176178 20:57113818-57113840 CCTCGGCCAAGAGGAGGATCCAT No data
Right 1175176185 20:57113867-57113889 ATTTTAGTTACACATGATGGTGG No data
1175176178_1175176184 23 Left 1175176178 20:57113818-57113840 CCTCGGCCAAGAGGAGGATCCAT No data
Right 1175176184 20:57113864-57113886 CTTATTTTAGTTACACATGATGG No data
1175176178_1175176182 -8 Left 1175176178 20:57113818-57113840 CCTCGGCCAAGAGGAGGATCCAT No data
Right 1175176182 20:57113833-57113855 GGATCCATTCAGTCAGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175176178 Original CRISPR ATGGATCCTCCTCTTGGCCG AGG (reversed) Intergenic
No off target data available for this crispr